FC931082

Overview
NameFC931082
Unique NameFC931082
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length701
Libraries
Library NameType
PostHarvP1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig14529 contig Ccv1_Contig14529:75..775. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of FC931082 vs. ExPASy Swiss-Prot
Match: NUD14_ARATH (Nudix hydrolase 14, chloroplastic OS=Arabidopsis thaliana GN=NUDT14 PE=1 SV=2)

HSP 1 Score: 315.464 bits (807), Expect = 1.781e-85
Identity = 157/200 (78.50%), Postives = 179/200 (89.50%), Query Frame = 3
Query:   57 SSPSPLTQSITIPSQLSQPVHVVAAPGLSESDFRCAVESTLFKQWLKNLQSETGILANGDMFLKQVLIQGVDMFGKRIGFLKFKADIFCKETGQKVPGIVFARGPAVAVLILLDSEGETYAILTEQVRVPTGRVILELPAGMLDDDNGDFVGTAVREVEEETGIQLKLEDMIDLTAFLYPSTGCKFFPSPGGCDEESACF 656
            SS S LTQSIT+PSQ ++PV V A  G+S SDFR A++S+LF+ WL+NL+SE+GILA+G M LKQVLIQGVDMFGKRIGFLKFKADIF KETGQKVPGIVFARGPAVAVLILL+S+GETYA+LTEQVRVPTG+++LELPAGMLDDD GDFVGTAVREVEEE GI+LK EDM+DLTAFL PSTG + FPSPGGCDEE + F
Sbjct:   38 SSSSSLTQSITLPSQPNEPVLVSATAGISSSDFRDAIDSSLFRNWLRNLESESGILADGSMTLKQVLIQGVDMFGKRIGFLKFKADIFDKETGQKVPGIVFARGPAVAVLILLESDGETYAVLTEQVRVPTGKIVLELPAGMLDDDKGDFVGTAVREVEEEIGIKLKKEDMVDLTAFLDPSTGYRIFPSPGGCDEEMSVF 237          
The following BLAST results are available for this feature:
BLAST of FC931082 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 1
Match NameE-valueIdentityDescription
NUD14_ARATH1.781e-8578.50Nudix hydrolase 14, chloroplastic OS=Arabidopsis t... [more]
back to top
Properties
Property NameValue
Genbank descriptionC34101C02EF PostHarvP1 Citrus clementina cDNA clone C34101C02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931082 ID=FC931082|Name=FC931082|organism=Citrus clementina|type=EST|length=701bp
ACTTTAATTACAGATCATCGAGAACGAGACTAGTTTGTTCCAAAATGCCC
ACCGAGTCATCGCCATCGCCTTTGACTCAATCTATCACCATCCCGAGTCA
ACTCAGCCAACCCGTCCACGTTGTTGCTGCCCCTGGTCTCTCCGAGTCCG
ATTTCAGGTGTGCTGTAGAATCAACTTTGTTCAAGCAATGGTTGAAAAAC
CTGCAAAGCGAAACTGGGATTTTAGCCAATGGTGATATGTTCTTGAAACA
AGTTCTTATTCAGGGAGTGGATATGTTTGGGAAGCGTATTGGTTTTCTAA
AGTTTAAAGCAGACATTTTTTGTAAGGAAACGGGACAAAAGGTTCCAGGT
ATTGTATTCGCACGAGGACCAGCTGTAGCTGTCTTAATTCTTTTGGACTC
GGAAGGTGAGACTTATGCTATTCTCACTGAACAGGTAAGGGTTCCCACTG
GGAGAGTTATATTGGAATTACCTGCTGGGATGCTGGATGATGACAATGGT
GATTTTGTTGGCACAGCAGTCCGCGAGGTTGAGGAAGAGACTGGTATTCA
GTTGAAGCTGGAAGACATGATTGACCTCACAGCCTTCTTGTACCCATCTA
CTGGATGCAAATTCTTCCCTTCTCCGGGAGGGTGCGATGAAGAATCAGCC
TGTTTCTTTTCAGAGGAAGAGTGGACAAGGAATCATCATGCAGCTGCAAG
G
back to top