FC931095

Overview
NameFC931095
Unique NameFC931095
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length736
Libraries
Library NameType
PostHarvP1cdna_library
Alignments
Feature NameTypeLocationAnalysis
FC931095_ssr209 microsatellite FC931095_ssr209:209..232.
FC931095_ssr399 microsatellite FC931095_ssr399:399..410.
FC931095_ssr438 microsatellite FC931095_ssr438:438..458.
FC931095_ssr472 microsatellite FC931095_ssr472:472..489.
FC931095_ssr636 microsatellite FC931095_ssr636:636..647.
FC931095_ssr14 microsatellite FC931095_ssr14:14..33.
Ccv1_Contig15272 contig Ccv1_Contig15272:1..737. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC34101D04EF PostHarvP1 Citrus clementina cDNA clone C34101D04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931095 ID=FC931095|Name=FC931095|organism=Citrus clementina|type=EST|length=736bp
AAACTTCTCAAGGGAAAAGAAAAGAAAAGAAAAAAAAAGTCATCAAGATG
CAACAGCAACAAGACGGGAGCTTGAGTATGAGCTCCGCTGCGGTGTCGTT
TTGCCCCAGTTTCAACAGCTACGCTTCCGAAAGAATAGTGAACATCGCCG
CCAAAGTTAGCGAAGAGTTTCGAGATGAAGAATCGAAATCCGAATCAAAA
GTTCTATTAGAAGAAGAAGAAGAAGAAGAAGAATATGTAGATGAAGATGA
TGAATTCGAGTTTGTTTCTACGATCGCAGATCTCGATTCCAGGTTGTTTC
TCGACGGCGAGATCCGTCAGGTTTTTCCAGTGTTCAATCGCAGTCTTTTA
TTAAACGAAGTTTGCGACGATCATGATCGAGGAAACGAAGGGGGACACGC
GGCGGCGGCGTTGAAGAAGTTGTTTATTGATGATCACGATGATGATGATG
ATGATGATGCTGGCAGGCAAGCGTCGTCGTCGTCGTCGTCTTCATCGGAC
GAAGACGAACCGGAACCGGAACCGAATATGAACGTAACTTTCTGCATTTG
GTCGCCAAAGAGAAATAACAATCCAACATCGTCGGCGTCGCCGTTGCAGT
CGCCGAGTCGATGCAAGAAGAGCAACTCAACTGGATCGTCGTCGTCGTCA
ACGCCGTCGAAGAAATGGTTTAACTCCGCGATTTGCTGAGGAGAGCACAG
CGACGGCAAGACTCGTTGTGTTTTTGAATACCGAGA
back to top