FC931145

Overview
NameFC931145
Unique NameFC931145
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length691
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34102A01EF PostHarvP1 Citrus clementina cDNA clone C34102A01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931145 ID=FC931145|Name=FC931145|organism=Citrus clementina|type=EST|length=691bp
TTTTTTTTTTTTTAAAGACATCGAATTTCAACTTCTGACATACTAAAAAA
TAAAAATAAAAACGGCTGTGCAGGTCAAACCGGCAGAAGGTGCAATAAAA
CGGCGTCGCCGATTTGCTATATTCGAAACGACGCCGTTCCCTGTATCTTT
CTAAGTTATTCCTTTCTCACCATATCTCCATTGAATCCGAAACACGGAGA
GAACTCACTTTCAGAATTTAGTGGCGTTGAATGATGATACAGCAACAAGG
AAAAAAAGTGGGACTTCCACTCATGAATCTTGTGAGATTAAACAGAACAC
CCATTTTGAAACAACTGCATTTGGAGGAAAAATTGCTTCGTAAATCGTCT
ACTAATTGGTGCATCATTAATGATGGAACAGATACTCCTGCCATTGTGAT
GGGCATTTCTGGGTAAGTATGTTAAGGAAACCTTCGGAACTTCTTGAAAT
TGGGTCAGTGTTACGAGATCAGGTTCCTGTCATCAAAAGGTTTACTGGAG
GAGGCACGGTTGTTGTTGACAAGGGAACTGTTTTTGTCACTTTGATATGC
AACAAGGATGATGTTCCTGGCGTGCAGCCATATCCCCGTTCCATCATGTC
TTGGAGTGGTCTTTTGTATAATCAAGTGTTTAAAGGGATTGCTGATTTCC
ACTTCGCGAGAATGGTATCTGTTCTGATCTCTGCTTGAAAT
back to top