FC931150

Overview
NameFC931150
Unique NameFC931150
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length662
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig2677 contig Ccv1_Contig2677:305..966. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34102A06EF PostHarvP1 Citrus clementina cDNA clone C34102A06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931150 ID=FC931150|Name=FC931150|organism=Citrus clementina|type=EST|length=662bp
GGCACCAAACTGATCTAACAAACTCCAAAAACTTTAAACTTTAAACCCAC
TAAAAAGGCCACAAAACTTTCTCTCAAAAAAATATGAAGAGCCAAAACCA
AAACCAAAACCAGAACTTATCAACTTCATTCACCAAACTCTTTAACGCAC
AGCTGCATATCTTCAATCTGCTTTCGTTCTTTCTCTTCTTTGGCTGTGGT
CTAATTTTTGGGATCGTTCTAAGTTTCTCTTTGAAAGATTTTTCTTTTAA
TCTTCACATCACGCAGTTCTCTCTTTCTCCTCCTTCAACATCAATAAAAG
TGGCAGCTTCGTCACAAAAGTTGTCAAATTCCAGTCGAGTTGGACTTGCT
GAATTTCTGAAGCCACCGAATACAACACATGATATGGAAGATGCAGAGCT
GTTGTGGAGAGCTTCAGTGGTTCCTAAAATTCCTGAGTATCCATTCAAGA
GAGTTCCAAAAGTTGCTTTCTTGTTCCTGACAAGGGGTCCTGTTCTGTTG
GCTCCATTGTGGGAGAAATTCTTCAAAGGCCATGGAGGTTTTTATTCAAT
TTATGTTCACTCTAGTCCGTCCTTCAACCAATCTGATGCAGAGCCCGAAG
GTTCTGTGTTTTACGGGAGAAGAANCCCAGCCGGGAGGTTAAATGGGGAG
GTGTTATATGAT
back to top