FC931161

Overview
NameFC931161
Unique NameFC931161
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length710
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34102B05EF PostHarvP1 Citrus clementina cDNA clone C34102B05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931161 ID=FC931161|Name=FC931161|organism=Citrus clementina|type=EST|length=710bp
AATGAGTTCTGTACTGATTTATAACCTGCCAGAGACGATCCGTGAAGCTG
ACATATCACGGTTGTCTTTTGCTGTTGAGCTTGCTGAAGAATTCTATGGA
AGAGTGAAGGGACAAGATGTTGCTTTTGAGCCAGCAAAACTTGTGTGGCT
TATCCAGCGTGATTTTTTGCAAGGGAAATCTGTGCAAGAGATGGTGCATG
ATGCACTTCAACGTGTTCCAAATGATAAAGGGGACAAAAATATTGATATG
GTTAACCAGATCCGCAACTCTCTGGCTATAATGGGTGACAACAGCACAGC
CTTTAGCTTACCGCAACCTCATCTGCTGCGAACAAAACTTTGTGACATGA
AAGATGAAGAACTTGACCCAATATATGTGAAAAGAAGGGAACAATTGAAA
AAGCTTGTTGCTAGTGTTACTCGTCCAAAAATTGTGCAGGGAAAATTTCT
AAATGGAAACGAGTTTGTTGCTTTCATGGAACAGGTATCTCTGTTTGCAC
CTGAGATGGTTAACAATCATTCATGGTTTGATTGAGAGTTTTAGAGTTCC
CTGACCTTTCTATCAACTTAGGTGGATTAGGCATGAAAGTTGATGACAAC
TCAAATTGGAAATTTAGGTAATTTTAGACCTACGTCCTTTAGGAATAGCT
GGTATTCCTTTTTTGATCACCTGATTGTTCTTAGTATCTATGATAGTGCA
TGAATCTTGG
back to top