FC931164

Overview
NameFC931164
Unique NameFC931164
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length691
Alignments
Feature NameTypeLocationAnalysis
FC931164_ssr152 microsatellite FC931164_ssr152:152..163.
Ccv1_Contig15285 contig Ccv1_Contig15285:1..691. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34102B08EF PostHarvP1 Citrus clementina cDNA clone C34102B08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931164 ID=FC931164|Name=FC931164|organism=Citrus clementina|type=EST|length=691bp
TTTTTTTTTTTTAGCGGCCATAATAAAAATTGAACGCTGTAGTAAGTGGT
TCTTGCCAACCATAGCAATAGCAATAGCAATAGCAAATAGCAATTAGCAA
ATAGCAACGGTAGGGTAGGCTTCTTTCTTCATCATTATCTTTTTTCATTT
CATTTATTTATTTTTTATATTCCACTCACCATTTTCTCTGGTGCTCATTC
ATAGCATATCCTTTTAGCTTTCTTGAAATAACTCACCCCATGGTTTCTCT
CTTTTTGCTCCTTACTAATAATGCTGTGCTGAGAGTTCTCTGACAAGCTT
TCTCTGATTTCTGGTATCAGGATTCAGCTACAGAGAGTTGAAGTTACAGG
GGCCTCAAAATTTTCTTTTTATCCAAAAAAAATAATTTTTACAGCATGTC
TGTTACATTGCTGTGGGTTGTATCACCTAACTCACAATTGTCCAATTGCT
TCGGGTTCGTCGATTCAGTTCGAGAGGAAAACAGGCTGTTTTATTCATCA
AGATTTCTTTACCAACATCAAACCCGGACTGCTGTGTTTAATTCTAGACC
TAAGCAGTTTAATAATAGTAATAAGCAGAGACGGAATTCTTATCCTTTAG
ATACAGATTTGAGGCATCCTTGCTCATCTGGAATCGACTTGCCTGAAATA
TCATGTATGGTTGCTAGCACTGCTGGAGAAGTGGCCATGTC
back to top