FC931168

Overview
NameFC931168
Unique NameFC931168
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length732
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC931168_ssr226 microsatellite FC931168_ssr226:226..240. BLAST: Citrus ESTs to Prunus persica proteins V1
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34102B12EF PostHarvP1 Citrus clementina cDNA clone C34102B12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931168 ID=FC931168|Name=FC931168|organism=Citrus clementina|type=EST|length=732bp
GAATTTCCTTTTGAATTTCGTGCATTAGAAGTTTTACTAGAAGCCATCTG
TAGTTTTCTTGATGCGCGTACAAGGGAATTGGAGACCGATGCTTATCCTG
CTCTAGATGAGTTGACTTCCAAGATTAGCAGTCGTAATTTGGATCGGGTG
CGTAAATTGAAGAGTGCGATGACAAGGTTGACAAATCGGGTTCAAAAGGT
CAGGGATGAACTTGAACAACTGCTAGATGATGATGATGATATGGCAGACC
TTTACTTATCAAGGAAGTTGGCTGTAGCATCTTCACCTGTCAGTGGTTCT
GGTGCTCCCCATTGGTTTCTTCTCTCTCCCACTATTGGTTCTAAAATATC
AAGAACAATAAGTAGGGGGAGCGTGGAAACAACTCAAGAGGAAAATGATG
TTGAGGAACTTGAAATGTTGCTTGAGGTTATGAAGTCATATACTTGTCAT
AGCTCTTATTTAACATTTCAAATTTGAGTTGGACGTTGGGTTTCTTTTGC
AGGCTTACTTTATGCAAATTGATGGGACATTGAACAAGTTGAGCACGCTG
CGTGAATATATAGATGACACAGAGGATTACATTAATATTCAGCTTGATAA
CCATCGAAATCAGCTGATTCAGTTAGAGCTTTTCCTATGTTCTGGGACTG
TTTGCTTGTCTGTGTATTCTTTGGTGGCTGCAATATTTGGCATGAACATC
CCATATACATGGAAGACAGGCCATGGATATGT
back to top