FC931180

Overview
NameFC931180
Unique NameFC931180
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length755
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34102C12EF PostHarvP1 Citrus clementina cDNA clone C34102C12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931180 ID=FC931180|Name=FC931180|organism=Citrus clementina|type=EST|length=755bp
GAGGCTAAGAGTCAGGAACAGTCAATATGGAGTGGAGCACTCTAGAACTG
AAAGTTAATTCTTGCAGTGATCTAAAAGCTTTCAATCTTTTCAACAAGCT
ATCTGTCTATTCCGTTGTGTCCATAATAAATGGTGAGTTAAAGAAGAAAG
AACAGCGGCAAACTTGTTTGCAGAGGCAAAAGACTCCGACAGACAGAGAG
GGAGGCGGGAATCCCGAATGGAATCATATGATGAAGTTTGATATCAAAGC
TTTTGTTGATAATTGCAATCATCTTTTCATTGCCTTCGATTGTACTCTGA
GGGTGTCATTTATGGTTACAGAAGCATTGGTAAGGTCCACGTTCCACTGA
AAGACTTGATTGATGAGTTCAATGGAGCTGTACGGTTTGTTAGGTATCAA
ATTCGGACCGGCCATGGAAAGCCAAATGGGGTCTTAAGTTTTTGTTATAA
GCTGAAGGGGATGACGATCAAGAAGGGCGAAATACCTTCTCCGGAAGTTT
GCTTATCCCCTGGAATCCATTCTCCTAAGGAGAAAGTTAATTATCCTTGT
GTTGAAGTTGATGATCTGTCTTCTCCAGGCATCTGCTATCCTCCACTAGA
TTATGTTTGTTCACCTTTACCGGGATTTTATTCNACCTCCACCAATTACC
AATATGAAAGCAACAAGGGTTATGGCACAACACTGCCACCACTTTCTCCA
GTACAAGTGTCATCGCTTTACGTGGCAAGTGGATCGCACTACCATCCATG
CCCTT
back to top