FC931244

Overview
NameFC931244
Unique NameFC931244
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length702
Libraries
Library NameType
PostHarvP1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig89 contig Ccv1_Contig89:193..893. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC34103A11EF PostHarvP1 Citrus clementina cDNA clone C34103A11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931244 ID=FC931244|Name=FC931244|organism=Citrus clementina|type=EST|length=702bp
ACTCATTCTGCGAGCTAGCTTATCAGCATTTGAATTTAGGTTGTTTTTGT
GTTTTTCTTGATTTCCTTTTTCTACTAATCTTTGCTAGTTTCGGGTTCCA
AATGCGGATCCTCCCCATCTCCGGAGAAGCACTTGTGTGCCTCTTGGTGG
CCCTGCTGTTTGCTGTGAACTTTTGCCATGGCAGTGATAGTAAGACAGTT
GAAGTAGTTGGAAGTGCAGAATGTGCAGATTGTGCACTCTCTAACATTAA
GCCTAGCGAGGCTTTTTTCAGGACTTCGAGTAACTATAGATTGTAAGCAG
GAAAATGGAAACGGAGGGTTCAAAACAAGAGGGACGGGCGAGCTCGATGT
CAAAGGTGAGTTCAAGGTATCACTTCCGGAGGAAATTGTTGAAGATGGAG
AGCTCAAGGAAGACTGTTATGCACAACTTCATAGTGCATCAGGCACTCCA
TGTCCAGCTTACGGTGGCTTAGAGTCTTCAAAGCTTGTTTTGAAGGTAAA
AACCAATGAAAAGCACACATTTGGCTTGGCCAAGAATAAGAAGCTGAAGT
TTTCACCCCCAATTTGTGCTGCTTCAACCGCTGCTTATACTCGTCCTTCT
CCTGTTCGCCCACCGGTACCTACTCCGCCATTTTGGCGCCGCTGTCGACT
ATGTGGCGGCCGCCGCATATGTTGTGGGAAAGTATGAAGACAGGAAACCG
CA
back to top