FC931310

Overview
NameFC931310
Unique NameFC931310
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length726
Libraries
Library NameType
PostHarvP1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Homology
BLAST of FC931310 vs. ExPASy Swiss-Prot
Match: CK5P3_ARATH (CDK5RAP3-like protein OS=Arabidopsis thaliana GN=At5g06830 PE=2 SV=2)

HSP 1 Score: 223.402 bits (568), Expect = 9.706e-58
Identity = 127/241 (52.70%), Postives = 166/241 (68.88%), Query Frame = 2
Query:    2 ALSAAKYVEACQELGLQGKSVRHELLETANSLPSTFSRILEVISSDSMSQAMEYYSTFVRDVHTHAEKGKSVAVLLNLKDVRENPPSMNVSAASEIVGSVDVQSSSNDNQIVGEDTKAAGDSIDWDISVDSPQIDWDIGTVEETEDAGNGLGPYEMVNASEFLEGPQETDQTPSNKEGNTLPAALSASEVSWDISVDTPQVDVIDDANPPNISMENQKSVPDILTQSPGISEDRSQLLETE 724
            ALSA KY +AC+ELGLQG +VR ELLETA+SLPSTFS+ILEVI+SDS++ AMEYYS +V+DVHT  +K   + VL NLK +RENPPS++V   SE + + ++QSS N N      T AA DSIDWDI+V++P+IDWD+  VEE  D+GN LG YE+VNAS+    P+ +       +G      +  SE+SWD+SV+TPQV+ I D+    +   NQ  + D  TQ  G   +RSQLLETE
Sbjct:  158 ALSATKYEDACRELGLQGNNVRRELLETASSLPSTFSKILEVINSDSVTGAMEYYSAYVQDVHTEKDKPLRI-VLQNLKYIRENPPSLSVFGDSEGLDADNIQSSENAN-----GTDAAADSIDWDITVETPEIDWDVSMVEEV-DSGNDLGSYEIVNASDI---PENSPFKVEESQG----LEVDVSEISWDVSVETPQVEEIGDS---ALLESNQTQLTDSTTQVLGSGGERSQLLETE 381          
The following BLAST results are available for this feature:
BLAST of FC931310 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 1
Match NameE-valueIdentityDescription
CK5P3_ARATH9.706e-5852.70CDK5RAP3-like protein OS=Arabidopsis thaliana GN=A... [more]
back to top
Properties
Property NameValue
Genbank descriptionC34103G05EF PostHarvP1 Citrus clementina cDNA clone C34103G05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931310 ID=FC931310|Name=FC931310|organism=Citrus clementina|type=EST|length=726bp
GGCTCTATCAGCAGCTAAATATGTTGAGGCCTGTCAAGAACTTGGGTTGC
AGGGAAAAAGTGTGAGGCATGAACTATTGGAGACTGCTAATTCGCTTCCA
AGCACATTTAGCAGGATTTTGGAAGTCATAAGTAGTGATTCGATGTCACA
GGCTATGGAGTATTATTCCACTTTTGTCAGAGACGTTCACACTCACGCGG
AGAAGGGTAAATCGGTGGCTGTCTTACTGAACTTGAAAGACGTTCGTGAA
AATCCCCCATCAATGAATGTCTCTGCTGCTTCTGAGATCGTTGGTTCTGT
TGATGTTCAATCAAGCTCTAATGATAATCAGATTGTGGGAGAGGACACAA
AAGCTGCTGGAGATAGCATTGACTGGGATATTTCAGTTGACAGTCCGCAG
ATTGATTGGGATATTGGTACTGTGGAAGAAACAGAAGATGCTGGCAATGG
CTTAGGTCCGTATGAAATGGTTAATGCTAGCGAGTTCTTAGAGGGTCCTC
AGGAAACTGATCAAACTCCATCAAATAAAGAGGGCAATACCTTGCCTGCT
GCACTTTCTGCTTCTGAGGTATCATGGGATATTAGTGTTGACACTCCTCA
AGTTGATGTGATTGACGATGCTAATCCGCCAAATATCAGCATGGAAAATC
AGAAATCTGTTCCAGATATTTTAACCCAATCCCCAGGAATCAGTGAAGAC
AGAAGCCAGCTACTGGAGACAGAGTA
back to top