FC931324

Overview
NameFC931324
Unique NameFC931324
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length706
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34103H07EF PostHarvP1 Citrus clementina cDNA clone C34103H07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931324 ID=FC931324|Name=FC931324|organism=Citrus clementina|type=EST|length=706bp
GTAATCTTTCAAGTATCTGCTCTCAGATTTAATAGTGCCCGGTTTCACTT
TTGGTTGGGAAAGCAATACAGAGAAACAGTTTCAGGCTTTGGGGCCGCCT
ATTTTTGCGATTTGGAGGACTATGTGTAGCACCTAGTTTTAAGAGCATGA
CTTATCGAATGTCAATGTGGTGATCTGAAGTTGATCTGCTTGTTAGCAAA
TTCTTGGAGCAAAGGAATATGGTTTTCCTCATTAGCTATACTCATTTCAG
TGTTGAATGGACTTATGTTGTAATAATCGTCGTAACTTCTTGTTATATTC
TTATTTTCCTGTTACTGTATATGGTTAATGCTTGGTTTCAGAGTACCTTT
ATATCTCCTGCTTGAATGCTTTTAAGTTTTGAGCTTTGAAATATTATCAT
CCTCTCATGGGTGCTTAGTCCATGACATTTGCTCTACATTTCATGTGTTG
AATAACTAATCAGTGAAATGAACCTCGTCCATGGTATTGGTGATGATGTC
CTAGTACAACCTAGATTTGCCATGAAGCTAACTCAACATAGAACGGGGCA
TGCTAGGGTCTTCCCATTTTTTATTAAACTAGATGTAACAAAAGTTGATC
CTGGTTATTGGTCTATGTGCTCTGTATGATAACTCTAGCCTGGCCTGCAN
GAATTTTCATCTGATGTCTGTTTTTATTCATGAAATGAGGATTTGGCTTA
AAATGA
back to top