FC931326

Overview
NameFC931326
Unique NameFC931326
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length692
Libraries
Library NameType
PostHarvP1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC34103H09EF PostHarvP1 Citrus clementina cDNA clone C34103H09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931326 ID=FC931326|Name=FC931326|organism=Citrus clementina|type=EST|length=692bp
ACTCATCCACCATTTGTTAATATGGATTTCCATGAGGTGGACTCTATTCC
TCGAGTTACAGTTCATTCTTTTTCTGATCTTGTTGGTCTAAATCAATCTG
ATAATGAAAATGCTTTCTCTGCTTGGAATGAGGATGTGGTGGTCCTTTTT
AGTAGTAGTTGGTGTGGGTTTTGCCAGAGAATGGAACTGGTTGTTCGTGA
AGTATTTCGAGCAGTAAAAGGCTACATGAAAAGTTTGAAGAACGGATATA
AAAATGGGCAAAGGGATTTAAATGGTGAATATTTGAAGAATATTAATTTT
AAACTTCCTCGGATCTACTTAATGGATTGCACATTGAATGATTGCAGTTT
GATCCTAAAGTCCATGACTCAGAGGGAAGTCTATCCTGCTCTGGTGTTAT
TTCCAGCGGAGAGGAAAAATGCTATCTCTTTTAAAGGAGATATATCTGTA
GCTGATGTTATCAAATTTATAGCTGATCATGGAAACAATTCTCATGATCT
GTTGAATGAGAATGGGATTATATGGACTTTACCCGAAAAAGAAGGCAGAT
ATCAAAACCTGTTTGAGGATCCATCACCAACTATTGGTAACAAGGAAGCT
TCTGTCACAGAGGAAGGTTTGCATGAAGTCATATTGAAGAGCGAGACATC
NAAAGCTGCCGAAAGAGATAGTTGGACTAAATCTCACACATC
back to top