FC931383

Overview
NameFC931383
Unique NameFC931383
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length718
Alignments
Feature NameTypeLocationAnalysis
FC931383_ssr692 microsatellite FC931383_ssr692:692..701.
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34104E08EF PostHarvP1 Citrus clementina cDNA clone C34104E08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931383 ID=FC931383|Name=FC931383|organism=Citrus clementina|type=EST|length=718bp
GAAAAAACACACACAACACAGTACACACCCAAGAGAACAAGACCCAACAC
AGCTTCACGGCTTCACCTAGTTACCCTCACATCACGCCGCCGACAGCCAC
AGCCACGAACCCACAACCATCTCCCTCGCTGAACTTCTCATCTCTAAGCA
CCAGCAACTTCTCATTCTAGACTAGAAGAAAGACCCCTCTTCATGCTCGA
TCTCGATTTGTTACGGGTCTGCAATTTGCTGTTGTGCGTCCGCGGCCAGT
CGACCACCAATCTGCTCCCAAGTGCCATTGATCTACTGCACCAAGCCTCC
AACTTGACAGCAACTGCAAGTGTAACCTGAATACCTGATTTTGCTCTAAG
CCTCCAACCCGACCCCTTTTGAGTTTTGAGACTTTTGAGTTTTGAAATTG
AAGCTTTGCCCATTTGAAGACTTTGGCCGGTCTCTTATCCGAACCCGAAC
TCATCCGAATTCAATCCGATTTTTTGACCCGATTTAATCCGACCTGAATA
TATATCAGATCGGATCGGGTTATAAGTTCGGATTTCATTCGGATTAATTT
TTACCTAACCAGAACAACCTAGAACCTAATCGGATTGATCCGAACCCAAT
TTTGCCCACCCCTAAGTAGAAACCAAGCCGTTCACTGCTGAAATGATTTC
ATTCAAACCCCATGATCTTGCAATCCTTTCAACACACGCTTGAGAGAGAG
ATGTGTATTCATACCTTG
back to top