FC931395

Overview
NameFC931395
Unique NameFC931395
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length712
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig602 contig Ccv1_Contig602:18..729. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of FC931395 vs. ExPASy Swiss-Prot
Match: SPDE_COFAR (Spermidine synthase OS=Coffea arabica PE=2 SV=1)

HSP 1 Score: 270.011 bits (689), Expect = 8.758e-72
Identity = 134/228 (58.77%), Postives = 162/228 (71.05%), Query Frame = 1
Query:  130 STVVSGWFSESQSTSDKTGKTMYFNNPMWPGEAHSLKVKEILFKGKSEYQEVLVFESLAYGKVLVLDGIVQLTEKDECAYQEMIAHLPLCSIPSPKTV-----------------------------------SKKYFPELAVGFEDPRVRLHIGDAVEFLRQVPRGEYDAIIVDSSDPVGPAQELVEKPFFDTIAKALRPGGVLCNMAESMWLHTHLIEDMISICRE 708
            S+V+ GWFSE               +PMWPGEAHSLKV++ILF+GKS+YQ V+VF+S  YGKVLVLDG++QLTE+DECAYQEMIAHLPLCSIPSPK V                                   SK++FP++AVGFEDPRV LHIGD V FL+ VP G YDAIIVDSSDP+GPAQEL EKPFF+++AKALRPGGV+C  AES+WLH H+IED+++ CR+
Sbjct:   21 SSVIPGWFSEI--------------SPMWPGEAHSLKVEKILFQGKSDYQNVMVFQSSTYGKVLVLDGVIQLTERDECAYQEMIAHLPLCSIPSPKKVLVIGGGDGGVLREVARHLSVEQIDICEIDKMVVDVSKQFFPDVAVGFEDPRVVLHIGDGVAFLKAVPEGTYDAIIVDSSDPIGPAQELFEKPFFESVAKALRPGGVVCTQAESIWLHMHIIEDIVANCRQ 234          
BLAST of FC931395 vs. ExPASy Swiss-Prot
Match: SPD2_DATST (Spermidine synthase 2 OS=Datura stramonium PE=2 SV=1)

HSP 1 Score: 264.618 bits (675), Expect = 3.679e-70
Identity = 129/233 (55.36%), Postives = 164/233 (70.39%), Query Frame = 1
Query:  115 DAKCHSTVVSGWFSESQSTSDKTGKTMYFNNPMWPGEAHSLKVKEILFKGKSEYQEVLVFESLAYGKVLVLDGIVQLTEKDECAYQEMIAHLPLCSIPSPKTV-----------------------------------SKKYFPELAVGFEDPRVRLHIGDAVEFLRQVPRGEYDAIIVDSSDPVGPAQELVEKPFFDTIAKALRPGGVLCNMAESMWLHTHLIEDMISICRE 708
            ++ C S+V+ GWFSE               +P+WPGEAHSLKV++ILF+GKS+YQ+V+VF+S  YGKVLVLDG++QLTE+DECAYQEMI HLPLCSIP+PK V                                   +K++FP++AVG+EDPRV LHIGD V FL+ VP G YDA+IVDSSDP+GPAQEL EKPFF+TIA+ALRPGGV+   AES+WLH H+IE++++ CRE
Sbjct:   18 ESPCISSVLPGWFSEI--------------SPLWPGEAHSLKVEKILFQGKSDYQDVMVFQSTTYGKVLVLDGVIQLTERDECAYQEMITHLPLCSIPNPKKVLVIGGGDGGVLREVSRHSSVEQIDICEIDKMVVEVAKQFFPDVAVGYEDPRVNLHIGDGVAFLKNVPAGTYDAVIVDSSDPIGPAQELFEKPFFETIARALRPGGVVSTQAESIWLHMHIIEEIVANCRE 236          
BLAST of FC931395 vs. ExPASy Swiss-Prot
Match: SPD1_PEA (Spermidine synthase 1 OS=Pisum sativum GN=SPDSYN1 PE=2 SV=1)

HSP 1 Score: 261.536 bits (667), Expect = 3.115e-69
Identity = 127/228 (55.70%), Postives = 159/228 (69.74%), Query Frame = 1
Query:  130 STVVSGWFSESQSTSDKTGKTMYFNNPMWPGEAHSLKVKEILFKGKSEYQEVLVFESLAYGKVLVLDGIVQLTEKDECAYQEMIAHLPLCSIPSPKTV-----------------------------------SKKYFPELAVGFEDPRVRLHIGDAVEFLRQVPRGEYDAIIVDSSDPVGPAQELVEKPFFDTIAKALRPGGVLCNMAESMWLHTHLIEDMISICRE 708
            S+V+ GWFSE               +PMWPGEAHSLKV++ILF+GKS+YQ+V+VF+S  YGKVL+LDG++QLTE+DECAYQEMI HLPLCSIP+PK V                                   SK+YFP++AVGF DPRV L+IGD V FL+  P G YDA+IVDSSDP+GPAQEL EKPFF+++A+ALRPGGV+C  AES+WLH H+IED++  CR+
Sbjct:   40 SSVIPGWFSEI--------------SPMWPGEAHSLKVEKILFQGKSDYQDVMVFQSATYGKVLILDGVIQLTERDECAYQEMITHLPLCSIPNPKKVLVIGGGDGGVLREVARHSSVEKIDICEIDKMVVDVSKEYFPDIAVGFADPRVTLNIGDGVAFLKAAPEGTYDAVIVDSSDPIGPAQELFEKPFFESVARALRPGGVVCTQAESIWLHMHIIEDIVVNCRQ 253          
BLAST of FC931395 vs. ExPASy Swiss-Prot
Match: SPD1_ARATH (Spermidine synthase 1 OS=Arabidopsis thaliana GN=SPDSYN1 PE=1 SV=1)

HSP 1 Score: 261.536 bits (667), Expect = 3.115e-69
Identity = 130/259 (50.19%), Postives = 168/259 (64.86%), Query Frame = 1
Query:   37 KESNKNGSAGAIPSCCLKARASAPELDAKCHSTVVSGWFSESQSTSDKTGKTMYFNNPMWPGEAHSLKVKEILFKGKSEYQEVLVFESLAYGKVLVLDGIVQLTEKDECAYQEMIAHLPLCSIPSPKTV-----------------------------------SKKYFPELAVGFEDPRVRLHIGDAVEFLRQVPRGEYDAIIVDSSDPVGPAQELVEKPFFDTIAKALRPGGVLCNMAESMWLHTHLIEDMISICRE 708
            +E + NG A       ++      + +  C STV+ GWFSE               +PMWPGEAHSLKV+++LF+GKS+YQ+V+VF+S  YGKVLVLDG++QLTE+DECAYQEMI HLPLCSIP+PK V                                   SK++FP++A+G+EDPRV L IGD V FL+    G YDA+IVDSSDP+GPA+EL EKPFF ++A+ALRPGGV+C  AES+WLH  +IED++S CRE
Sbjct:   15 REEDDNGGAAT-----METENGDQKKEPACFSTVIPGWFSEM--------------SPMWPGEAHSLKVEKVLFQGKSDYQDVIVFQSATYGKVLVLDGVIQLTERDECAYQEMITHLPLCSIPNPKKVLVIGGGDGGVLREVARHASIEQIDMCEIDKMVVDVSKQFFPDVAIGYEDPRVNLVIGDGVAFLKNAAEGSYDAVIVDSSDPIGPAKELFEKPFFQSVARALRPGGVVCTQAESLWLHMDIIEDIVSNCRE 254          
BLAST of FC931395 vs. ExPASy Swiss-Prot
Match: SPD2_HYONI (Spermidine synthase 2 OS=Hyoscyamus niger PE=2 SV=1)

HSP 1 Score: 260.766 bits (665), Expect = 5.313e-69
Identity = 125/228 (54.82%), Postives = 160/228 (70.18%), Query Frame = 1
Query:  130 STVVSGWFSESQSTSDKTGKTMYFNNPMWPGEAHSLKVKEILFKGKSEYQEVLVFESLAYGKVLVLDGIVQLTEKDECAYQEMIAHLPLCSIPSPKTV-----------------------------------SKKYFPELAVGFEDPRVRLHIGDAVEFLRQVPRGEYDAIIVDSSDPVGPAQELVEKPFFDTIAKALRPGGVLCNMAESMWLHTHLIEDMISICRE 708
            S+++ GWFSE               +P+WPGEAHSLKV++ILF+GKS+YQ V+VF+S  YGKVLVLDG++QLTE+DECAYQEMI HLPLCSIP+PK V                                   SK++FP +A+G+EDPRV+LH+GD V FL+ VP G YDA+IVDSSDP+GPAQEL EKPFF+++A+AL PGGV+C  AES+WLH H+IED++S CR+
Sbjct:   13 SSILPGWFSEI--------------SPLWPGEAHSLKVEKILFQGKSDYQNVVVFQSSTYGKVLVLDGVIQLTERDECAYQEMITHLPLCSIPNPKKVLVIGGGDGGVLREVSRHSSVEQIDICEIDKMVIDVSKQFFPNVAIGYEDPRVKLHVGDGVAFLKNVPEGTYDAVIVDSSDPIGPAQELFEKPFFESVARALCPGGVVCTQAESIWLHMHIIEDIVSNCRQ 226          
BLAST of FC931395 vs. ExPASy Swiss-Prot
Match: SPDE_SOLLC (Spermidine synthase OS=Solanum lycopersicum GN=SPDSYN PE=2 SV=1)

HSP 1 Score: 259.61 bits (662), Expect = 1.184e-68
Identity = 128/228 (56.14%), Postives = 160/228 (70.18%), Query Frame = 1
Query:  130 STVVSGWFSESQSTSDKTGKTMYFNNPMWPGEAHSLKVKEILFKGKSEYQEVLVFESLAYGKVLVLDGIVQLTEKDECAYQEMIAHLPLCSIPSPKTV-----------------------------------SKKYFPELAVGFEDPRVRLHIGDAVEFLRQVPRGEYDAIIVDSSDPVGPAQELVEKPFFDTIAKALRPGGVLCNMAESMWLHTHLIEDMISICRE 708
            S+V+ GWFSE               +P+WPGEAHSLKV++ILF+GKS+YQ VLVF+S  YGKVLVLDG++QLTE+DECAYQEMI HLPLCSIP+PK V                                   +K++FP++AVG+EDPRV LHIGD V FL+ VP G YDA+IVDSSDP+GPAQEL EKPFF++IAKALRPGGV+   AES+WLH H+IE++++ CR+
Sbjct:   48 SSVLPGWFSEI--------------SPLWPGEAHSLKVEKILFQGKSDYQNVLVFQSSTYGKVLVLDGVIQLTERDECAYQEMITHLPLCSIPNPKKVLVIGGGDGGVLREVSRHSSVEQIDICEIDKMVVEVAKQFFPDVAVGYEDPRVNLHIGDGVAFLKNVPAGTYDAVIVDSSDPIGPAQELFEKPFFESIAKALRPGGVVSTQAESIWLHMHIIEEIVANCRQ 261          
BLAST of FC931395 vs. ExPASy Swiss-Prot
Match: SPD1_ORYSJ (Spermidine synthase 1 OS=Oryza sativa subsp. japonica GN=SPDSYN1 PE=2 SV=1)

HSP 1 Score: 259.61 bits (662), Expect = 1.184e-68
Identity = 127/228 (55.70%), Postives = 155/228 (67.98%), Query Frame = 1
Query:  130 STVVSGWFSESQSTSDKTGKTMYFNNPMWPGEAHSLKVKEILFKGKSEYQEVLVFESLAYGKVLVLDGIVQLTEKDECAYQEMIAHLPLCSIPSPKTV-----------------------------------SKKYFPELAVGFEDPRVRLHIGDAVEFLRQVPRGEYDAIIVDSSDPVGPAQELVEKPFFDTIAKALRPGGVLCNMAESMWLHTHLIEDMISICRE 708
            S V+ GWFSE               +PMWPGEAHSLKV+++LF+GKS+YQ V+VF+S  YGKVLVLDG++Q+TE+DECAYQEMI HLPLCSI  PK V                                   SK++FP LAVGFEDPRV LHIGD V FL+  P G YDA+IVDSSDP+GPAQEL EKPFF ++A+ALRPGGV+C  AES+WLH H+IED+++ CR+
Sbjct:   28 SAVIPGWFSEI--------------SPMWPGEAHSLKVEKVLFQGKSDYQNVMVFQSSTYGKVLVLDGVIQVTERDECAYQEMITHLPLCSIKDPKKVLVIGGGDGGVLREVSRHSSVEQIDICEIDKMVVDVSKQFFPHLAVGFEDPRVSLHIGDGVAFLKNAPEGTYDAVIVDSSDPIGPAQELFEKPFFQSVARALRPGGVVCTQAESIWLHMHIIEDIVANCRQ 241          
BLAST of FC931395 vs. ExPASy Swiss-Prot
Match: SPD2_PEA (Spermidine synthase 2 OS=Pisum sativum GN=SPDSYN2 PE=2 SV=1)

HSP 1 Score: 258.84 bits (660), Expect = 2.019e-68
Identity = 128/227 (56.39%), Postives = 156/227 (68.72%), Query Frame = 1
Query:  130 STVVSGWFSESQSTSDKTGKTMYFNNPMWPGEAHSLKVKEILFKGKSEYQEVLVFESLAYGKVLVLDGIVQLTEKDECAYQEMIAHLPLCSIPSPKTV-----------------------------------SKKYFPELAVGFEDPRVRLHIGDAVEFLRQVPRGEYDAIIVDSSDPVGPAQELVEKPFFDTIAKALRPGGVLCNMAESMWLHTHLIEDMISICR 705
            S+V+ GWFSE               +PMWPGEAHSLK+++ILF+GKSEYQ+V+VF+S  YGKVLVLDG++QLTE+DECAYQEMI HLPLCSIP+PK V                                   SK++FPE+AVGF DPRV L IGD V FL+  P G YDA+IVDSSDP+GPAQEL EKPFF ++A+ALRPGGV+C  AES+WLH  +IED++S CR
Sbjct:   48 SSVIPGWFSEI--------------SPMWPGEAHSLKIEKILFQGKSEYQKVMVFQSSTYGKVLVLDGVIQLTERDECAYQEMITHLPLCSIPNPKKVLVIGGGDGGVLREVARHSSIEKIDICEIDNMVVEVSKQFFPEVAVGFNDPRVTLRIGDGVAFLKAAPEGTYDAVIVDSSDPIGPAQELFEKPFFQSVARALRPGGVMCTQAESIWLHMDIIEDIVSNCR 260          
BLAST of FC931395 vs. ExPASy Swiss-Prot
Match: SPD1_DATST (Spermidine synthase 1 OS=Datura stramonium PE=2 SV=1)

HSP 1 Score: 258.455 bits (659), Expect = 2.637e-68
Identity = 123/228 (53.95%), Postives = 160/228 (70.18%), Query Frame = 1
Query:  130 STVVSGWFSESQSTSDKTGKTMYFNNPMWPGEAHSLKVKEILFKGKSEYQEVLVFESLAYGKVLVLDGIVQLTEKDECAYQEMIAHLPLCSIPSPKTV-----------------------------------SKKYFPELAVGFEDPRVRLHIGDAVEFLRQVPRGEYDAIIVDSSDPVGPAQELVEKPFFDTIAKALRPGGVLCNMAESMWLHTHLIEDMISICRE 708
            S+++ GWFSE               +P+WPGEAHSLKV++ILF+GKS+YQ V+VF+S  YGKVL+LDG++QLTE+DECAYQEMI HLPLCSIP+PK V                                   SK++FP +A+G+EDPRV+LH+GD V FL+ V  G YDA+IVDSSDP+GPAQEL EKPFF+++A+ALRPGGV+C  AES+WLH H+IED+++ CR+
Sbjct:   13 SSILPGWFSEI--------------SPLWPGEAHSLKVEKILFQGKSDYQNVMVFQSSTYGKVLILDGVIQLTERDECAYQEMITHLPLCSIPNPKKVLVIGGGDGGVLREVSRHSSVEQIDICEIDKMVIDVSKQFFPNVAIGYEDPRVKLHVGDGVAFLKFVAEGTYDAVIVDSSDPIGPAQELFEKPFFESVARALRPGGVVCTQAESIWLHMHIIEDIVANCRQ 226          
BLAST of FC931395 vs. ExPASy Swiss-Prot
Match: SPD1_HYONI (Spermidine synthase 1 OS=Hyoscyamus niger PE=2 SV=1)

HSP 1 Score: 257.684 bits (657), Expect = 4.498e-68
Identity = 126/228 (55.26%), Postives = 160/228 (70.18%), Query Frame = 1
Query:  130 STVVSGWFSESQSTSDKTGKTMYFNNPMWPGEAHSLKVKEILFKGKSEYQEVLVFESLAYGKVLVLDGIVQLTEKDECAYQEMIAHLPLCSIPSPKTV-----------------------------------SKKYFPELAVGFEDPRVRLHIGDAVEFLRQVPRGEYDAIIVDSSDPVGPAQELVEKPFFDTIAKALRPGGVLCNMAESMWLHTHLIEDMISICRE 708
            S+V+ GWFSE               +P+WPGEAHSLKV++ILF+GKS+YQ V+VF+S  YGKVLVLDG++QLTE+DECAYQEMI HLPLCSIP+PK V                                   +K++FP++AVG+EDPRV LHIGD V FL+ VP G YDA+IVDSSDP+GPAQEL EKPFF++IA+ALRPGGV+   AES+WLH H+IE++++ CR+
Sbjct:   21 SSVLPGWFSEI--------------SPLWPGEAHSLKVEKILFQGKSDYQNVMVFQSSTYGKVLVLDGVIQLTERDECAYQEMITHLPLCSIPNPKKVLVIGGGDGGVLREVSRHSSVEQIDICEIDKMVVEVAKEFFPDVAVGYEDPRVNLHIGDGVAFLKNVPAGTYDAVIVDSSDPIGPAQELFEKPFFESIARALRPGGVVSTQAESIWLHMHIIEEIVANCRQ 234          
The following BLAST results are available for this feature:
BLAST of FC931395 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 124
Match NameE-valueIdentityDescription
SPDE_COFAR8.758e-7258.77Spermidine synthase OS=Coffea arabica PE=2 SV=1[more]
SPD2_DATST3.679e-7055.36Spermidine synthase 2 OS=Datura stramonium PE=2 SV... [more]
SPD1_PEA3.115e-6955.70Spermidine synthase 1 OS=Pisum sativum GN=SPDSYN1 ... [more]
SPD1_ARATH3.115e-6950.19Spermidine synthase 1 OS=Arabidopsis thaliana GN=S... [more]
SPD2_HYONI5.313e-6954.82Spermidine synthase 2 OS=Hyoscyamus niger PE=2 SV=... [more]
SPDE_SOLLC1.184e-6856.14Spermidine synthase OS=Solanum lycopersicum GN=SPD... [more]
SPD1_ORYSJ1.184e-6855.70Spermidine synthase 1 OS=Oryza sativa subsp. japon... [more]
SPD2_PEA2.019e-6856.39Spermidine synthase 2 OS=Pisum sativum GN=SPDSYN2 ... [more]
SPD1_DATST2.637e-6853.95Spermidine synthase 1 OS=Datura stramonium PE=2 SV... [more]
SPD1_HYONI4.498e-6855.26Spermidine synthase 1 OS=Hyoscyamus niger PE=2 SV=... [more]

Pages

back to top
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34104F08EF PostHarvP1 Citrus clementina cDNA clone C34104F08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931395 ID=FC931395|Name=FC931395|organism=Citrus clementina|type=EST|length=712bp
GGAAAAGGTTTGGGATGCCAGAAGACTATGGATGGGAAGGAGAGTAACAA
GAATGGTTCAGCGGGGGCAATCCCTTCTTGTTGCTTGAAAGCAAGGGCTT
CAGCCCCAGAGCTTGATGCCAAATGCCACTCCACTGTTGTTTCTGGGTGG
TTTTCAGAATCTCAGTCTACCTCTGATAAAACTGGCAAAACAATGTACTT
CAACAATCCAATGTGGCCAGGAGAGGCCCATTCATTGAAAGTAAAAGAAA
TTTTATTCAAGGGAAAGTCTGAGTACCAAGAGGTCCTGGTTTTTGAGTCA
TTGGCATATGGGAAAGTGCTTGTTCTTGATGGAATTGTTCAACTAACGGA
GAAAGATGAATGTGCTTACCAGGAGATGATAGCTCATCTTCCCCTTTGTT
CGATTCCATCTCCGAAAACCGTTTCTAAAAAGTATTTTCCTGAGCTAGCT
GTTGGTTTTGAGGATCCTCGTGTACGACTGCACATTGGTGATGCTGTTGA
ATTCCTACGGCAAGTGCCCAGAGGGGAATATGATGCAATTATTGTTGATT
CATCAGACCCTGTAGGTCCTGCTCAAGAGCTTGTAGAGAAGCCATTTTTT
GACACAATTGCTAAAGCATTAAGGCCTGGAGGTGTCCTCTGTAACATGGC
AGAAAGTATGTGGCTTCATACTCACCTTATTGAGGACATGATTTCTATTT
GTCGTGAAACAT
back to top