FC931396

Overview
NameFC931396
Unique NameFC931396
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length581
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10191 contig Ccv1_Contig10191:77..657. BLAST: Citrus Unigene V1 Contigs to Trembl
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34104F09EF PostHarvP1 Citrus clementina cDNA clone C34104F09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931396 ID=FC931396|Name=FC931396|organism=Citrus clementina|type=EST|length=581bp
GTGGTGGAAACTGTGGGTGTGGTTCTAGCTGCGAGTGCGGCGGCGGCTGC
GGCGGTAGCGCCATGTACCCTGACTTGAGATCCTTTGAGAGCACCACCGT
CGCCACCGAGACCCTCGTCCTCGGTGTTGCTCCTGTCAAGATGCACTCTG
AGGGGTCCGAGATGGGATTCGGAGCCGAGGGCGGCTGCAAGTGTGGACCA
AACTGCAAGTGCAACCCTTGTAACTGTTAATGAAGATTACGAGACGTGAA
CATGCCCCATAATAAAGCAGCGCTGTGAGGTCGTTTAAATTGTAGTATCA
ATAAAAAGAACTATTTGTCTTTTGTGGTTGGCTTTGTTGGATGTCTTTTT
ATGAGCTTTTGTTTGTAAAATAAAAACCAGCCATGGCTGCTTCTCCGAAT
CCTTAACTGGGTTTGTTGCAGATCCATGGCTAGTTAATTAATCATTAAGT
GTATCTGTTACTGCTGCTTTTCTAATGGGAAGCTTCCTCTCAGACTTTTA
TCTATATTGTAAAATGTGTTTGGTTCATGTACTGTATAATAAATTTACAA
CGTTTGGNACAAAAAAAAAAAAAAAAAAAAA
back to top