FC931399

Overview
NameFC931399
Unique NameFC931399
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length171
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10129 contig Ccv1_Contig10129:355..525. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34104F12EF PostHarvP1 Citrus clementina cDNA clone C34104F12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931399 ID=FC931399|Name=FC931399|organism=Citrus clementina|type=EST|length=171bp
GGCACGATTGGTGCAATAATATGTCATGTTGTTATTAGTTGTAATAGGAT
ATTTATCCATGTCTGCCGGATATTTTGTAAGCTTTATAATAGTTGTGAAC
CGTGCTTTTGCAGCTATTAATTAACTAATGTTGTTTTGTTATTAAAAAAA
AAAAAAAAAAAAAAAAAAAAA
back to top