FC931409

Overview
NameFC931409
Unique NameFC931409
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length741
Libraries
Library NameType
PostHarvP1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig970 contig Ccv1_Contig970:6..746. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC34104G10EF PostHarvP1 Citrus clementina cDNA clone C34104G10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931409 ID=FC931409|Name=FC931409|organism=Citrus clementina|type=EST|length=741bp
GGATTGCCCACTTCAATTCTCTCCCGCAACATCAAAACCCATCTCTCAAT
TCCCTTCATTGAGTTTCTTTTTTCTTTTTTTTTCCCCAAGATTCAATCTT
GATTCAAGAACCCAAAAGGAAAAAAGACGACTCTTTCGGTTTATTATTAT
TCTTTTTCTGGAATTGATTTGTGAAGAAATTTTTTGTGAATGGTGGAAAC
AATTTTGAAGAGTAGTAATTTGATGCTCTCCCTTTGTGAATCAAGGGCGA
GCTCACCTCTTGCTTTTGCTTTTGGATCTTGCAAGGAAGGCTGGTACTAC
CGCTGCCTCGGTCTCGACCCATAAACGCCATATTTTTTTTCTGTTTTGTA
CCCCTTTTTGAAGCCCGCCAATAAAAAGACGAAGAAGAGATAAAAATCAG
ATTTTTTTTAAAATAAAAAAAACCCCAATTCAAGAGTTTTTGTTTAGATC
TTAATTAAATTTTGCGACAATGTTGTTGTACAAGCAAAAGAAGGCTCAAG
CTGTCAAGGGAAACAGGATCTTGATCAGCATTACTGTGCTGGGAAGCGCT
GGCCCGATCCGTTTTGTGGTGAATGAAGAAGAGCTTGTTGCTGCTGTTAT
TGATACCGCTTTGAAATCTTATGCTCGTGAAGGGAGGCTTCCCGTTCTCG
GCTCTGATCTCACGATTTCGTTCTCTATTGTTCAATGCTGGGTCTGGGCA
CTGAGCCTTGGGACACATTGGAAGACTGGATGCGTACTTTT
back to top