FC931410

Overview
NameFC931410
Unique NameFC931410
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length627
Libraries
Library NameType
PostHarvP1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC931410_ssr39 microsatellite FC931410_ssr39:39..50. BLAST: Citrus ESTs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC34104G11EF PostHarvP1 Citrus clementina cDNA clone C34104G11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931410 ID=FC931410|Name=FC931410|organism=Citrus clementina|type=EST|length=627bp
GTTGTAATTGTGTGCTTAGAGCAATGGGGTCAATGCCTGAAGGAAGGAAG
TGTGTTACATGCATTGGGTATCCTATTGATGAGGCTAAACGAGGGAGTTT
GGGAAAATGTTCTAGAATGCTAAAGCGCTTGCTTAATCCATTGGAGGTTA
AGCAAATAATGAAGGCTGAGAAGTTGTGTGAGGCGAATCAGTTGCCTCCG
GAGTATATTTGCGTAAATGGGAAACCTCTTTGTCATGAGGAGTTGGTTAT
ATTGCAGACATGTCCTAACCCACCGAAGAATCTAAAACCAGGGAATTATT
GGTATGATAAAGTATCTGGTCTTTGGGGAAAGGAAGGACAGAAGCCATCA
AAGATTATTAGTCCGCATCTAAGTGTTGGGGGTCCAATCAAGCCAGATGC
TAGCAATGGAAACACACAGATTTTTATCAATGGTCGGGAGATCACTAAAG
TAGAGCTGAGGATGTTGCAGCTGGCAGGAGTTCAATGTGCTGGCAATCCA
CACTTTTGGGTGAATGAGGATGGGTCATATCAAGAAGAGGGACAGAAGAA
TACTAAAGGATATATTTGGGGCATGGCTAAGACAAAGCTAGTCTGTGCTG
TTTTGTCGCTGCCAGTTCCTTNCAAAT
back to top