FC931411

Overview
NameFC931411
Unique NameFC931411
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length672
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34104G12EF PostHarvP1 Citrus clementina cDNA clone C34104G12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931411 ID=FC931411|Name=FC931411|organism=Citrus clementina|type=EST|length=672bp
GGTATTACAATCTGAGATAAAGTTGGAATACACTGACATATTTGGACAAA
AAATAAATTAAAGGAGTGCAATTGTGTTTGATGAGGTGTGGGTGAGTAGA
AGGGAATAGCCAGTAGTATTGAGTTTGGCACTTATAGCTAATATTTGGTT
AATTGAAATGACATAACAAAAGAGTGTGTGAGTAATAAGTGGTTTTCCTA
AAAGTTGTCAAATTCAGTAATATAATGCAATAAACATCTGTGAAGGTAGG
CCCAAAAGCAAAACAAAAGTTATACCAAAGGCAACCCAAAAGATATCATG
TGAGAATGATCATTACAGCCACACGTATTATTGGATGTCAGTTTGTTTGA
CTAAAGACATACACCATCTACCACACACAGTCTGCTAAAAGTCCAAAAAT
ATCAGGAAAAGGATAATAACACTACTAGAAAGAGAACAAAGTAATTGCAC
CACCTTATCAGGCTTTCCCATCCATCTCACTTCACCCCCAAGCTTTTCAA
ATTTAGATGCCAATGTACCTAGTATGATCAAAATACATTCATAACCAAAT
GGTAAACCAATAAAATTCCTAAATGTGAAATTCTTAGATATTGAGAAATT
CCTACTCGATAACTTGTGAGATGAGTATATAATATCGACAGACACTAGGT
TGAAGTTTCTTAAATCTGACAG
back to top