FC931415

Overview
NameFC931415
Unique NameFC931415
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length259
Libraries
Library NameType
PostHarvP1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15538 contig Ccv1_Contig15538:358..616. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC34104H04EF PostHarvP1 Citrus clementina cDNA clone C34104H04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931415 ID=FC931415|Name=FC931415|organism=Citrus clementina|type=EST|length=259bp
CTGATCATAAATGCCAGTACTGCTGGCGGGTTCTAGAGCTAATGTAGCAT
CCAGTGGTGATGTGTGCCTCATTGCTGATGTTGCCTTCCATGATATAACG
ATACCTATCCCTGTTTTCGATCTGTATGGAGTTGGTCAACGGCAGGCCTT
CTCGACACCCAATCTTTTGAGGGAACTTAACCTAAAGGTTTGCAAATTGT
CTACGGGTGACTCTCTAGATATGTCCTCACAAGATGAAACATCAATTACT
GCAAATGAT
back to top