FC931424

Overview
NameFC931424
Unique NameFC931424
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length614
Libraries
Library NameType
PostHarvP1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC34105A01EF PostHarvP1 Citrus clementina cDNA clone C34105A01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931424 ID=FC931424|Name=FC931424|organism=Citrus clementina|type=EST|length=614bp
ATCACTTATCCCCTTCAAACTGTAAATGCTCGTCAACAGACCGAGCGTGA
TGTTAAGAAAGAGAAGAGGAAGCTAGGAACTGTTGCACAAATGTGTCAGG
TTGTAAAACATGAAGGATGGGGACGGTTGTATGGAGGTTTAACACCGTCT
ATTGTCGGTACAGCTGCGTCTCAGGGTGTTTACTATTATTTCTATCAAAT
ATTCAGGAATAATGCTGAAGTTGCCGCACTTGAACATAAAAAGAGAGGGA
TTGGTGATGGATCGGTTGGGATGCTTTCATCACTTGTTGTGGCTGCCTTG
GCTGGGTAATTTTATGGAGTTCCTAGTGGATTTCGTTCACTATATATCTC
TGAACTTTATAAAACAATTGGAGCCATGTGGGCTGTTCTCATTTCTCATT
TACAATACTTGAATGTGATAAACCATATTTCAAAAATAATTCAGTTTTTT
TAGTAATCAAATTGAAAATCAAGTGAGAACACATTCTTTGGCTATGACTT
TCATCTATCTTTTGTTTCTTTGCCTATTTATGTTGATGCATTTTAATGCT
TAAATACGGTTGATGCTTTCTTTTCATAGGTGTGTGAATGTGTTGTTGAC
AAACCCTATTTGGG
back to top