FC931425

Overview
NameFC931425
Unique NameFC931425
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length572
Libraries
Library NameType
PostHarvP1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15357 contig Ccv1_Contig15357:4..575. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC34105A02EF PostHarvP1 Citrus clementina cDNA clone C34105A02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931425 ID=FC931425|Name=FC931425|organism=Citrus clementina|type=EST|length=572bp
GGTAGCCATTTGTTTGCGCCGGCCTCTTTCAGCTGTTTGCTTTCTTAGAT
CTATTCGTCTCTAAGTTCTCTCGCTTTTGTTTATTCAAATTCGAATAGAT
AGTCTTGGCTCATCATGGCTCTTCGCCTATTTTCTCAAAGCTTTGATCTG
GATCTTCGTATTTTCGTCAGATCGGCGAGCTTGCTGGGCTGTGATACGTA
AATCGGATGGTTCTGATTCCATGTATGGTGCTGACTCGATTTGGAATGGC
CCTTCGGATTAAGTCAGCGATGGATTGATCGTGATGGTGGCCGACCTAAT
CATGACGGTTCTGAAGCTGGATTGAATACGATCTATCTCCCGCAACGGCG
TGGCTTGTTGCGGAACACGTTTGCAGATGATAGTAAGATGGGGAAAAAAA
TCTTTGTTATGCTAGCTACCATATCGTGTAAGCTTAGTCTTTGCTTTATT
ACCTGTTAGCTGTTATAATATTATGTTGTGTGTGGAGGTGAAGGAGAAAA
AAANTTGTGACTGGCGAGGAAAATATGTGATCGGAAGTTGAGAGATAGAT
TTTACGTGTTGTGGTTGTTATT
back to top