FC931431

Overview
NameFC931431
Unique NameFC931431
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length732
Libraries
Library NameType
PostHarvP1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Homology
BLAST of FC931431 vs. ExPASy Swiss-Prot
Match: DRL21_ARATH (Putative disease resistance protein At3g14460 OS=Arabidopsis thaliana GN=At3g14460 PE=2 SV=1)

HSP 1 Score: 75.485 bits (184), Expect = 3.320e-13
Identity = 68/233 (29.18%), Postives = 98/233 (42.06%), Query Frame = 2
Query:   41 TLESLEVGNLPPSLKLLLVWGCSKLESIAEMLDNNTSLEKINI----SGCGNLQTLPSGLH-------------------------NLCQLQEISIASCGNLVSSPEGGLPCAKLAMLAIYNCKRLEALPKGLHNLKSLQELRIGKGVALPSLEEDGLPTNLHVLLINGNMEIWKSMIERGR-GFHRFSSLRQLTIMNCDDDMVSFPPKADDKGSGTALPLPASXTYLRIEGF 649
            +LES    + P +LK L +  C KL +  E L    S  ++      S C NL   P  L                          +   L+ + I  C NL + P+GGLP  KL+ + + NCK+L+ALP+ L  L SL  L I K   + ++   G P+NL  L I+    +   +  R   G     +LR L I   ++D+ SFP +           LP S   LRI  F
Sbjct: 1128 SLESFPGSHPPTTLKTLYIRDCKKL-NFTESLQPTRSYSQLEYLFIGSSCSNLVNFPLSLFPKLRSLSIRDCESFKTFSIHAGLGDDRIALESLEIRDCPNLETFPQGGLPTPKLSSMLLSNCKKLQALPEKLFGLTSLLSLFIIKCPEIETIPGGGFPSNLRTLCIS----LCDKLTPRIEWGLRDLENLRNLEIDGGNEDIESFPEEG---------LLPKSVFSLRISRF 1346          
The following BLAST results are available for this feature:
BLAST of FC931431 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 1
Match NameE-valueIdentityDescription
DRL21_ARATH3.320e-1329.18Putative disease resistance protein At3g14460 OS=A... [more]
back to top
Properties
Property NameValue
Genbank descriptionC34105A08EF PostHarvP1 Citrus clementina cDNA clone C34105A08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931431 ID=FC931431|Name=FC931431|organism=Citrus clementina|type=EST|length=732bp
ATCATTGACATGTATATTTTCAAAAAACGAGTTACCTGCCACGCTTGAGT
CCCTTGAAGTTGGCAATCTACCTCCGTCTCTTAAGTTGCTTTTAGTTTGG
GGATGTTCGAAGCTGGAGTCAATAGCAGAAATGTTGGACAACAACACATC
TCTTGAAAAAATCAACATTTCTGGTTGTGGAAATCTTCAAACTTTACCGA
GTGGTTTACATAATCTTTGCCAGCTTCAAGAGATTAGTATTGCGAGTTGT
GGAAATCTGGTGTCCTCTCCGGAAGGGGGATTGCCTTGTGCGAAACTCGC
AATGCTGGCGATATATAATTGTAAGAGACTAGAGGCTTTACCCAAGGGAT
TGCACAATCTGAAGTCTCTTCAAGAATTAAGAATAGGAAAAGGAGTTGCG
CTTCCAAGCCTTGAAGAAGATGGCCTTCCCACCAACCTTCATGTACTGCT
GATTAATGGTAATATGGAGATTTGGAAGTCAATGATTGAGCGGGGCCGGG
GATTTCACAGATTCTCCTCTCTGCGACAACTTACAATCATGAATTGTGAT
GACGACATGGTGTCATTCCCACCAAAGGCAGATGACAAAGGATCGGGGAC
CGCGCTTCCTCTTCCTGCCTCTCNTACATATCTGAGGATTGAAGGTTTTC
CAATCTGGAACGCCTAACTTCTTCATTGTTGATCTTCAAACCTCACTGGA
TTGGTTCTCGGGGGATGTCGCAGCTCAATACT
back to top