FC931476

Overview
NameFC931476
Unique NameFC931476
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length730
Libraries
Library NameType
PostHarvP1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15336 contig Ccv1_Contig15336:1..731. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC34105E07EF PostHarvP1 Citrus clementina cDNA clone C34105E07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931476 ID=FC931476|Name=FC931476|organism=Citrus clementina|type=EST|length=730bp
GGATACGAAGCCTTTAACGGTTGCACTTCCGTCCAGATCTCGCTCTTTAA
TTTCTAGGTTTTGCGGATCGGATTTGAATTTTTTTTCACTAATTTTGGAA
TTTCGATTGTGGAATCGGAGAACCAATGGCGAAACCGAGGTATTCGCGAT
TCCCGACGCGAAAATCGTCGTCTTCGACTTTGATCTTGACATTGCTGATC
ATGTTCACGTTCGCGATTTTGATTCTTCTCGCGTTCGGGATCCTATCCAT
GCCGAGCAGTTCCGGCGATTCGCGGAAAGCCAACGATCTCAGCTCCATTG
TACGCAAGTCTATGGAGAGAAGTGAAGGAGATGAAGGGAGAGCAGAGCAA
TGGGTTGAGGTGATCTCTTGGGAGCCTCGAGCTTTTGTTTATCATAATTT
CTTGAGCAAGGAGGAGTGCGAGTACCTAATCAATCTTGCCACGCCTCATA
TGAGAAAGTCGACTGTTGTTGATAGTGATACTGGCAAGAGCAAAGATAGC
AGGGTTCGGACAAGTTCTGGAACATTTCTTGCTAGAGGACGAGACAAAAT
TATTAGAGATATTGAGAAAAGGATTGCAGATTTCACTTTCTTACCTTTAG
AGAATGGAGAAGGACTTCAAGTTCTCCATTATGAAGCTGGACAAAAATAT
GAGCCTCACTTTGACTATTTCATGGATGAGTTCACACCNAGAATGGGGGG
GCACGCATGGCTACGGTGCTAATGTACCTC
back to top