FC931522

Overview
NameFC931522
Unique NameFC931522
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length702
Libraries
Library NameType
PostHarvP1cdna_library
Alignments
Feature NameTypeLocationAnalysis
FC931522_ssr174 microsatellite FC931522_ssr174:174..185.
Ccv1_Contig15345 contig Ccv1_Contig15345:1..702. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC34106A06EF PostHarvP1 Citrus clementina cDNA clone C34106A06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931522 ID=FC931522|Name=FC931522|organism=Citrus clementina|type=EST|length=702bp
GAAATGGCAAAGCAAATCATCTCCAACTTCTAAGGTTGTAGAAAGAACAC
AAGGTTGAGATCCGAGCGATGAAGGAGGCATTGAGGCAAATCGCCTGCAC
GTCCAGCGCTGGGATGGATACCCAGAGGCGGTACTCTGCTGGTCTTGGTT
TTGTGAATAAGCAGAGTCATGAGCATCATCATCATGGTGGGTTTGTTGAG
ATGAAGAAGAAAGAGACAGTAGGTAGTATTAAGAAAAAGTTGAAATTGTT
AAAAGGGTTGTCAAAGGACTTGTCCACTTTTTCTCAGATGGGATTTGCCG
TTGATCAAGATCAAAACTTGCTCGCTCAAGTACGAGGCAAAATGATCTCG
GAAGCAGCAGAGGTTTTAATGAAGCAGCTTGAACAGTTGAAAACAGAGGA
GAAGAAATTGAAGAGGAAAAGAAAGCAAGAAAAAGCAAATAAGCTTAAAG
CGAAAATACAGTCATCAGCATGTGAAAGCAGTGATTCTAGTGACAGCGAA
TGTGAAGAAGAGGAGGTCGTTCAAATGATAGACGGCACTCAGGTGGAAGA
CGGCCTTCTTAATCTTATGCCTGTGATAAGATCAGAAGAGAGCTCGCCCT
CCCCAAATGTTGTTGGAACTGATGATGGGATGACAAAGAGGGTAGAGGTT
TGCATGGGAAACAGTGCAAGAATCAGGAGGTGGTGCATTGTTTGAGGATT
TC
back to top