FC931774

Overview
NameFC931774
Unique NameFC931774
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length720
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15390 contig Ccv1_Contig15390:1..720. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
PostHarveNcdna_library
Properties
Property NameValue
Genbank descriptionC34201A10EF PostHarveN Citrus clementina cDNA clone C34201A10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931774 ID=FC931774|Name=FC931774|organism=Citrus clementina|type=EST|length=720bp
GGAGTTTAACAAAAGTGGATGCGAAGCTACAATACAGAACACGAACGAGA
GAGAAATCGAGAAACGAATAGGACAGCAGAGGCAAAATAGGCAAATGGTT
TCTCTCTCGACTTGGTTTCGATACATAGCCAACAAGCTTGAGTACTCCGT
CTCTATCAGTTGGAAGAGCTACACGCGAGGTCAAATCAATGATATAGAAT
TACGTGATTCGGTTTGGAAATATTTGTTTCAGGGAAAGTTAACTTACTTA
TACGGGAATAAAGGAGATCAGATGGCTCCAGTTATGGGAGGGCTAGGGGG
AACCCTTCTTGTGCGGAAGTTACCTGCTGCAGATCCAAAGCGTGTTTCTG
TTGGAGATGTGGTGGTCATGAAAGACCCTGAGAAGTCAGATAATTATATC
GTGAGAAGATTAGCTGCTATTGAAGGGTATGAAATGGTGTCAACTGACGA
GAAAGATGAGCCTTTTGTTCTTGACAAGGATGAATGTTGGGTGTTGGCTG
ACAATGAAAATATGAAGCCTAAGGAAGCCAATGATAGTCGAACATTTGGT
CCAGTTCCCATGAGAAACATAGTTGGCAGAGCCATATATTGCCTTCGAAC
AGCTGTGGATCATGGTCCTGTACAGAACAGTAATGATAGCATGCGAAAGG
ATTCACCAGTATTGGAGGTGGAACTGGATGTTGATGAGATGATGAAAAAC
CACAAGCATAGAGCTTGCTC
back to top