FC931778

Overview
NameFC931778
Unique NameFC931778
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length682
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC931778_ssr195 microsatellite FC931778_ssr195:195..204. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig15391 contig Ccv1_Contig15391:1..683. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
PostHarveNcdna_library
Properties
Property NameValue
Genbank descriptionC34201B02EF PostHarveN Citrus clementina cDNA clone C34201B02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931778 ID=FC931778|Name=FC931778|organism=Citrus clementina|type=EST|length=682bp
TTAAAATAATTTTGCCCACTTTCTCTAGGAAACTTTTCCGAGAAACAAAC
AACTGACAATAATGGAGTCGACGCCTGTGAACTGGGAAGCTCTGGACGCA
CTCATCCTCGAGTTCGCAAAATCTGAGAACTTAATCGAAGACTCAATTGT
ATCATCTCCACCATCTTCTCCGTCTTCTTCTTCCACGTCTTCGGTCTCTC
TCTCCTCTTCGTCTTATCACTCGAGATTGATCATTCGACAGATCAGACGG
TCGTTAGAATACGGTGACATTGACGCCGCGATTGATCTCCTCCGCGCTCA
CGCGCCTTTCATTCTCGATGATCACAGGCTTCTTTTCCGGTTACAGAAAC
AGAAATTTATTGAACTTTTGAGAAGAGGAACTACAGAGGATAGAAAATCA
GCGATCAATTGCTTGAGGACTGCTCTTGCACCCTGTGCTCTTGATGCTTA
TCCGGAAGCATATGAAGAATTCAAGCATGTCCTTCTCACCTTTATATATG
ATAAAGATGATCCGACTTCTCCGGTCGCAATTGAGTGGGCTGAAAGGCGG
AGGTTTGAAATTGCTGGATTGATGTCCTCTGTCTTAAGGGCTCATTTACA
TGCATACGATCCAGTTTTTGCTATGACTCTCAGATATTTAATCAGCATAC
ACAAAGAATTTTGCTTTCATCAAGGAGTTCCG
back to top