BG732218

Overview
NameBG732218
Unique NameBG732218
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length166
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13777 contig Csv1_Contig13777:537..702. BLAST: Citrus Unigene V1 Contigs to Populus V2 proteins
Libraries
Library NameType
Citrus sinensis flavedo cellscdna_library
Properties
Property NameValue
Genbank descriptionCs-13d Citrus sinensis flavedo cells Citrus sinensis cDNA clone Cs-13d similar to ATERD10 Arabidopsis thaliana mRNA for ERD10 protein, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BG732218 ID=BG732218|Name=BG732218|organism=Citrus sinensis|type=EST|length=166bp
CGACTGATGTGGGGTGCTCAGCAGCAGGAGGAGAAGGGACCTGATGATCT
TCAGGTTTCTTTTGCTGTCCTGGTAGTTTCTCCTTGATCTTGTTGAGAAA
TCCTTTCTTTTCTTCAGGATGGGCTTCTTCCTGGTGGTGGGGAGCATGGA
CATCATCAAGTTTCTC
back to top