BG732220

Overview
NameBG732220
Unique NameBG732220
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length361
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1 contig Csv1_Contig1:2..362. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Citrus sinensis flavedo cellscdna_library
Properties
Property NameValue
Genbank descriptionCs-1a Citrus sinensis flavedo cells Citrus sinensis cDNA clone Cs-1a, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BG732220 ID=BG732220|Name=BG732220|organism=Citrus sinensis|type=EST|length=361bp
CAGTGAGCGTCCGTCCAGCATATTAAACCAAGCTTCACAGAGTCACCCAA
AAAATTCATCCTTGATGCCAATTAGGACAAGAGAAGCATTGACATAGAAT
CTATAGAGTAGGCCTCGTTTACAGGAGAAAATTGTCAATCATATGTTGGA
TCACCTCGGCTCCATCGGAATTGATACAGTAGGTTTTCACCTGAATGGTA
CTGTGTGCTAGAAATCTTTGCCTGCTTCTACTGAAGTTAACGTCAACCCG
TTCCCAGCTCAAAGTCGTTAAACATCTGAGCATTTCCTCTTCCACATCAG
CAGTTTCACTTTTATTTGCTATGTTCTCTGAACGGACTTCTCTTTGTGAA
CTAGCTGCTTC
back to top