BG732221

Overview
NameBG732221
Unique NameBG732221
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length643
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2 contig Csv1_Contig2:1..642. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Citrus sinensis flavedo cellscdna_library
Properties
Property NameValue
Genbank descriptionCs-1c Citrus sinensis flavedo cells Citrus sinensis cDNA clone Cs-1c, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BG732221 ID=BG732221|Name=BG732221|organism=Citrus sinensis|type=EST|length=643bp
GGGAGCAGCTAATTAGACTTGTGCAAGATTTGGTTACCAAGAACTTTGAA
ACTGCTGAGCAGTATGGAAAGAAACGAATAAGCTCAGCTGATTTATTGGG
TGTTCTTCGAATGATTTGGAAAGATGTTTTGCTGATGGATGAAGTGTTAC
ATGAAGCTGTTCTCTCAGAGTTTTCCCTGGAGGCTGCCCAGATTACTGTC
AAACATTATGTTGCCAGCCAATTTTCTCTTCTTCTACATGATATATCAGA
TGCCCTTACAAAAGTTTATGTTGGACAAAAGGAGGGAATGGAAGAATGCC
CCTTGCAGGTTGCCCTGGAGGCCAGCAAAAAAGCTGTACTTCAAGGCAGC
ATGGATGTCTTGTTGGAATTCCGCCAACTTCTTGATGACGAGATTGGGGT
ACTAGTTAAACTAAAAGACTTGATTATTGATTGGGTTCAAGAAGGATTTC
AAGAGTTCTTCAGGGCACTTGACAACCGATTCCTATTGCTTTCGGGAAGA
AATAACTCATCTAGTCCAGTTCAAGGTTTGGAGGGAACGCAGGGTGACAA
AGTTCTTGTTGGGCTTGTTTTGGTACTGGCCCAACTATCTGTCTTCATTG
AGCAAACTGCCATCCCACGAATTACCGAGGAGATAGCTGCTTC
back to top