BG732298

Overview
NameBG732298
Unique NameBG732298
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length221
Alignments
Feature NameTypeLocationAnalysis
BG732298_ssr109 microsatellite BG732298_ssr109:109..123.
Csv1_Contig2858 contig Csv1_Contig2858:152..372. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Citrus sinensis flavedo cellscdna_library
Properties
Property NameValue
Genbank descriptionCs-3b Citrus sinensis flavedo cells Citrus sinensis cDNA clone Cs-3b, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BG732298 ID=BG732298|Name=BG732298|organism=Citrus sinensis|type=EST|length=221bp
CGAAACGAAGTCGTCGTTGGAGACTCCGCCGCCGCTGCTGAGGCAACTGA
CGGTTGCGGAATATGAGGCGGAGAGAAGGCCCCGTCTCGTCGGCCAGCGG
ATGACGTCGTGGTGGTGGTGGTGGTTGCGGGAAAACGGCGCGCGATGGAG
GTGGAGAGGATTGAATGACGCGTCGGTGTTGGTATTGGTGCTGGTGGTGA
TGCGAGAGAGAGTGAAAGCTC
back to top