BG732299

Overview
NameBG732299
Unique NameBG732299
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length220
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13053 contig Csv1_Contig13053:841..1060. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Citrus sinensis flavedo cellscdna_library
Properties
Property NameValue
Genbank descriptionCs-3c Citrus sinensis flavedo cells Citrus sinensis cDNA clone Cs-3c, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BG732299 ID=BG732299|Name=BG732299|organism=Citrus sinensis|type=EST|length=220bp
CGATGATGTCTGAGCTGACGAGGTATCGTCTCCGGGACTTTCCCACGTAA
ACGGGGTGAAGATCACCCGAGTAGTTGGCGGAGGAATCGTCCGCGGCGGC
CACTGCGGAGCTCATGCCGGGCCTGCAGCTTCCTCCGCCGCTGCCGTTTT
GTTTGTTGAATGAGTTGAGCTTCTTCAGAACTGACTTGAGCTTCATCAGC
TTGCCACCTTTCGCCGTTTC
back to top