BG732300

Overview
NameBG732300
Unique NameBG732300
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length219
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
Citrus sinensis flavedo cellscdna_library
Properties
Property NameValue
Genbank descriptionCs-3d Citrus sinensis flavedo cells Citrus sinensis cDNA clone Cs-3d, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BG732300 ID=BG732300|Name=BG732300|organism=Citrus sinensis|type=EST|length=219bp
CGAAACTGTCAGCAGAACGAGCACTGGCGCCGTCTCCAATTGTATGGTAG
ATCAAGCGGCTACTGAATATAGGCTCCGAGAAGCAGCTCAAAGGAGCAAT
AAAGCTGGTGAATGAACTGGCTGAGACGATGATACATCAACGGCGCCAAA
TGGGCTTCTCCAGCAAGAACGATCTGTTATCAAGATTCATGGCCTCCATT
GACGACGACAAATATCTTC
back to top