BG732301

Overview
NameBG732301
Unique NameBG732301
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length217
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig182 contig Csv1_Contig182:657..873. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Citrus sinensis flavedo cellscdna_library
Properties
Property NameValue
Genbank descriptionCs-3e Citrus sinensis flavedo cells Citrus sinensis cDNA clone Cs-3e, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BG732301 ID=BG732301|Name=BG732301|organism=Citrus sinensis|type=EST|length=217bp
CAGCACCCTCGCAAGCTTGCGAGCTCTAGGCTATGATATTAGTGCCGATG
ATTACCACGGTTTCGTGCACGGAAGATTGCCGTATGATTTTATCAAACCA
GATCCTCAACTACGCAACCTCTTATGCAGCATCACCCAGAGAAAGATTAT
TTTCACCAATTAAGACAGGAACCATGCAATTACATGTCTGAAACGACTAG
GAATAGCAGATTGTTTC
back to top