BG732302

Overview
NameBG732302
Unique NameBG732302
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length189
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10209 contig Csv1_Contig10209:53..241. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Citrus sinensis flavedo cellscdna_library
Properties
Property NameValue
Genbank descriptionCs-4a Citrus sinensis flavedo cells Citrus sinensis cDNA clone Cs-4a, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BG732302 ID=BG732302|Name=BG732302|organism=Citrus sinensis|type=EST|length=189bp
CGAAACGAGTATATATTAAAATTACACTAAAATCATAAATTTAACACACA
CATATATAGTATAGTTGCACTTGGATTCAAGAGCAAGTACATATATCTAC
ATTATTGCGCTCCTAAGTAATTAAACAAGAAATCAAAAGCACCATTGATT
TTTCACATAATCTGAATATCTTTAGTATCTAAACTTGTC
back to top