BG732305

Overview
NameBG732305
Unique NameBG732305
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length150
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9484 contig Csv1_Contig9484:243..392. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Citrus sinensis flavedo cellscdna_library
Properties
Property NameValue
Genbank descriptionCs-5a Citrus sinensis flavedo cells Citrus sinensis cDNA clone Cs-5a, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BG732305 ID=BG732305|Name=BG732305|organism=Citrus sinensis|type=EST|length=150bp
CGAAATGTTCGGTTGTATGGACAATTTTCGGCTCCGGTGAAGCCGAGCAA
AGAAGGAGAAGAAAAGCACAATTATTATGTTAACATGGGCTACGCGATTC
GGACTTTACGAGAAGAGTTTCCAGCTCTCTTTTATAGGGAGCTCAGTTTC
back to top