BG732306

Overview
NameBG732306
Unique NameBG732306
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length143
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10986 contig Csv1_Contig10986:466..608. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Citrus sinensis flavedo cellscdna_library
Properties
Property NameValue
Genbank descriptionCs-5e Citrus sinensis flavedo cells Citrus sinensis cDNA clone Cs-5e, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BG732306 ID=BG732306|Name=BG732306|organism=Citrus sinensis|type=EST|length=143bp
CGAAACATCAATATCCACGACCCAGGACACCTTCAAAAGCTTAGAGGAAA
GCGTAGATGGTCTTAAGGGCGAGTATGCTGACTTTACAATAGCCACTAAG
GCCCTCATCCAAAACCAAGCCAACACCCTTCAAGGGGCATTTC
back to top