BG732309

Overview
NameBG732309
Unique NameBG732309
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length535
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
Citrus sinensis flavedo cellscdna_library
Properties
Property NameValue
Genbank descriptionCs-8e Citrus sinensis flavedo cells Citrus sinensis cDNA clone Cs-8e, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BG732309 ID=BG732309|Name=BG732309|organism=Citrus sinensis|type=EST|length=535bp
CAGTGAGCGTGAGATTTCTCTAGCGAAGTCCCCTGAAGAATTTATTGGAC
AGTTTGAGTTATTGATAAAGGTTATATTGGAGGGTCCCATCCAGAGTTCT
GATGAAGAGTCTGACTCTAGGCCAAAACGCTGGACCATCAGGTCTCAGCT
TGCTGCATTTGATAAAGCATGGTGCTCCTACTTGAATTGCTTTGTGATGT
GGAAAGTTAAGGATGCCAAGTCATTGGAAGATGATTTGGTGAGAGCAGCA
TGCCAGCTGGAACTCTCGATGATTCATAAGTGCAAGATGACTGCAGAAGG
AGATAATGGTGCTCTTACTCATGATTTGAAGGCTATCCAGAAACAGGTTA
CAGAGGATCAAAAACTTCTAAGAGAAAAAGTCCAACATCTTAGTGGAGAT
GCTGGGATGGAGCGGATGGAATGTGCATTATCTGAAACCAGATCTAAATA
CTTTGAAGCGAAGGAAAATGGAAGCCCAATAGGGTCGCCAATCACAAACT
TCTTATCTACCAGTCACCTAGTTCTCAGCTGCTTC
back to top