BG732310

Overview
NameBG732310
Unique NameBG732310
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length171
Libraries
Library NameType
Citrus sinensis flavedo cellscdna_library
Properties
Property NameValue
Genbank descriptionCs-9g Citrus sinensis flavedo cells Citrus sinensis cDNA clone Cs-9g, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BG732310 ID=BG732310|Name=BG732310|organism=Citrus sinensis|type=EST|length=171bp
GGAAGCAGCTACAGGAGTCGTAGAGAAAATGAAAGAAATGGCCATAAAGT
CCAACAGAGGCACACATTAATCACTCAGTTCCAATTACTAACAACAGTAA
TAGAAATAATATTTGGCAAGACTGTTAGTCTCCCGGGTTTATTCACGCTC
ATCTGTTTATTCACGCTCACT
back to top