BG732313

Overview
NameBG732313
Unique NameBG732313
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length215
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
Libraries
Library NameType
Citrus sinensis flavedo cellscdna_library
Properties
Property NameValue
Genbank descriptionCs-11a Citrus sinensis flavedo cells Citrus sinensis cDNA clone Cs-11a, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BG732313 ID=BG732313|Name=BG732313|organism=Citrus sinensis|type=EST|length=215bp
CGAGAACAATTGAGGAAGTGGAAGAGGGTTTTGTGAGAATAGACATGCCT
TCAACACCAACTACTTCAAGAAGAGTTAATTTTTCTCCCATGCCTAGTCC
TTGTTTTGGCAAAATAAATGATTTCCCTGTTCCTTCTTCATCAAAAAGTA
AAACAACCTTAAAAAGCCTCCTTCCAAAGCTAAGTTTCAAATATCGTAAT
ACTACTTCAGATATC
back to top