BG732314

Overview
NameBG732314
Unique NameBG732314
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length208
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10147 contig Csv1_Contig10147:1103..1310. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Citrus sinensis flavedo cellscdna_library
Properties
Property NameValue
Genbank descriptionCs-11b Citrus sinensis flavedo cells Citrus sinensis cDNA clone Cs-11b, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BG732314 ID=BG732314|Name=BG732314|organism=Citrus sinensis|type=EST|length=208bp
CGAAAGAGGCACATTTTGGTTAAGGATGGATTCCGAGTCCTCTAGACTTG
CTGTCTTTGGATCAAAAGGCCGCTCCCTTCCAGGAATACTTAACCCCTGT
TTCATTTGACCCAATCGTCGCGAATGTAGAACTTGTGCTGAAGTTACAGG
CTTCCTAATGGATTGATATTCTTCCAGAGCAGAGTATAAATGATCCGGCC
CCCACTTC
back to top