BG732317

Overview
NameBG732317
Unique NameBG732317
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length114
Libraries
Library NameType
Citrus sinensis flavedo cellscdna_library
Properties
Property NameValue
Genbank descriptionCs-12b Citrus sinensis flavedo cells Citrus sinensis cDNA clone Cs-12b, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BG732317 ID=BG732317|Name=BG732317|organism=Citrus sinensis|type=EST|length=114bp
CGGTCAGGACTCATAGGGTATTGTAAGTGGCAGAGTGGCCTTGCTCCCAC
GCCCCCCTCAGATTCAGCCCTATGTTGCTCAGATTTGTCTGCAAAGAACA
GAGACGAAGGTCGG
back to top