BQ622913

Overview
NameBQ622913
Unique NameBQ622913
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length418
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9214 contig Csv1_Contig9214:152..569. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00004 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00004 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ622913 ID=BQ622913|Name=BQ622913|organism=Citrus sinensis|type=EST|length=418bp
TACCCATCTTCTTCATCTTCACACATAACCCGTTGCTGCTCTTATCCTTC
ACCGTCATTGGCGTCGGCGCCTTCCTTATGCTCCTCTCGCTTGCCTCTCT
CTTTTATTCAAGTGAGGCATGTGTCATCAAGGGATCGGAAGAAGAGGAGG
AAGCCGGTGACTCCAGTTACATCGAAAGTGAAGAAGATTAAAATGAAGTC
ATATTCGTCATACAAGTCAAGGTTTAGGACAATGAACGATGGACAAGTAC
GTCGCTGGCATGAGGGTAAAAGACATAATGCACACTTGAAGTCAAAAAAA
TCAAAAAGGAGACTCAGACAACCTGCGTTAGTTCCTCTCGCTTATGCCAA
GGTGATGAAGAAACTGAACTTTTGTGGTTAACCCTCCAGAAGTCAAGGTA
CTGTTACCATGTTCATCT
back to top