BQ622915

Overview
NameBQ622915
Unique NameBQ622915
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length360
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00006 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00006 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ622915 ID=BQ622915|Name=BQ622915|organism=Citrus sinensis|type=EST|length=360bp
AAAATCAATCAAAACAAAAACAGAATCTGATTCTCAGAGATATTTTCGCC
GTTCAATCGAGTACCAAATCGAATCAATCCAAAACATCAACATTCATTTC
CAAATTCTTCTTCGATCGATCTGCATTTCGTCTCACATCATTTCAGTGAA
GTAGGGAAATGGAGGGAACAGCGTTTAGTCCATCACTGGAAGGAATGAAG
CACGTGAAGTCTGAGCAAGGCGAGATGCTTACCAAGCCTTTCTTGGAAGT
TTGCAAACTGATTTTGCCTGTTTTGGATAAGTTTGGAGCGGCTATGTCTC
TTGTAAAGTCAGATATTGGTGGTAATATTACGAGGTTGGAGAATAAATAT
TCATCCGATC
back to top