BQ622917

Overview
NameBQ622917
Unique NameBQ622917
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length359
Alignments
Feature NameTypeLocationAnalysis
BQ622917_ssr145 microsatellite BQ622917_ssr145:145..156.
BQ622917_ssr216 microsatellite BQ622917_ssr216:216..230.
Csv1_Contig1003 contig Csv1_Contig1003:77..435. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00008 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00008 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ622917 ID=BQ622917|Name=BQ622917|organism=Citrus sinensis|type=EST|length=359bp
GCGGCCGAACCAAAGACAGTGACCGAAGATGCGAAGATCGACTTGTTTGA
AGACGACGATGAGTTTGAAGAGTTTGAAATCAACGAAGAATGGGAGGAAA
AGGAGGAAGGGAATGAAGTAACACAGCAGTGGGAAGACGATTGGGATGAT
GATGATGTCAACGATGACTTCTCTCTGCAGCTGAGGAGGGAACTGGAGAA
CAATGCTGAGAAAAACTGAGCTGAGCTGAGTAACTTGTCATTGTTGTGTG
TCATATCTTCCTATTCTGTTGTCACTTGAAGATGGCGAGTTTCAAATCTT
TTGTATGCAAAAGAACTTGTGAACTATTAACCATATGCTTGGAAGCTCAG
TGCAATTTG
back to top