BQ622935

Overview
NameBQ622935
Unique NameBQ622935
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length545
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00026 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00026 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ622935 ID=BQ622935|Name=BQ622935|organism=Citrus sinensis|type=EST|length=545bp
CTATATTCATGTTGTTCTGTTTAATTTGATGTGCAGATGTGGAATGGTTG
TAAAGGTGAGTCCACAAATTCCTACTATTTCTGGCTTTGAAGCTACGTTA
GAATAGCTGTTACTGACCATCTTCAAATAAATTATAATTGGGTCAATCAA
TCGCCAAAGTTCATGTTATGATGGCAGTTTGTAAATCTAATTTGCTATGC
CAATGTGCATAGACGCCTATGAAAGATAAACTCAGTTTTTCTATTTGGAA
CCTAATAAACATTCTCTGTTTAACAAGTCCAACTCCCCTCCTTTCATATT
CATGCATTTGATCTCATTATGCAAACTTATTGTGATTTCAGGGTTTGACT
GAAAAATTCAAGGAGAAGGATCCACGGTATACTGGGTCAGCCACGCTTAC
CTATGAATCATTCATGAGTATAGTCATTCCATTTATTGTGTCATATGATT
GATTTAATTTGTACAATTAGCCTTGCAATGGTGATTTCTTTATTGTTAAA
GTTCAAATACTTATCTGGGTTTGAAGTTGTATATTGAGAAATGGT
back to top