BQ622937

Overview
NameBQ622937
Unique NameBQ622937
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length349
Alignments
Feature NameTypeLocationAnalysis
BQ622937_ssr310 microsatellite BQ622937_ssr310:310..321.
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00028 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00028 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ622937 ID=BQ622937|Name=BQ622937|organism=Citrus sinensis|type=EST|length=349bp
AACTACTTGCGCAGGAAAAAAGTGGTCAGAGGGTTTTAACTTCCGGTACG
AAGGTATTGCTAATGATGATATCATGAACGACAATCTTGATCTTCTTATT
GTTCCTCAATATGGAAGAAATCCCGATCATATGGGTTAAGTGCAATACTG
GTCTTTTATGTTTTATTTAATTAAATAAATGATAGGTGTACTATTACCTA
TCAGTTATGTCAATGTCTCAGTCCAGTTTAATGTAACTTAAAAGATTTCT
TGAGATGTACAAGAGATCTTCTTTGTTTGCTTTTGAGTTAAGTATTTTCC
TGAAAAGGAAAATAAATAAATAAAAGTTATTGTGTGTGTCAACATATTA
back to top