BQ622951

Overview
NameBQ622951
Unique NameBQ622951
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length580
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10065 contig Csv1_Contig10065:99..677. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00042 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00042 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ622951 ID=BQ622951|Name=BQ622951|organism=Citrus sinensis|type=EST|length=580bp
CAAATTCACTGTTTGCTTTCAGATCAATCAGAAAGGTTGCTTTTACGTCT
TCTGCTTCTGCTTCTGTGAAATGGAAAGGTGGGGTTTCCTTGGTTCAAGG
AGCCTTCTAGAGGAATTGGCCTTGAATTTGCTAAGCAACTGCTGGAGAAA
AATGATAAAGGCTGTGTTATTGCCACCTGTCGTAATCCAAATGGGGCAAC
AGGTCTTCTCGACTTGAAAAATAGGTTTCCTGAACGACTTGACGTTTTAC
AGTTGGATTTGACAGTGGAAAGCACCATAGAGGCATCTGCAAAGTCTATA
AAAGAAAAATATGGCTGTTTGAACCTTCTCATTAATGCTTCTGGCATTCT
CTCAATACCGAATGTCTTGCAACCAGAAACAACGTTAAACAAAGTAGAGA
AATCATCCTTGATGCTTGCTTATGAGGTTAATGCGGTGGGTCCTATCCTA
GTGATAAAGCATATGTCGCCTCTTCTTAAAGTCGGAGGCACTGGGATTGA
GAGGGATGTTGCTGTTGTGGCCAATTTAAGTGCCAGGGTAGGATCCATTG
GGGACAATCGCCTAGGTGGTTGGCACTCTT
back to top