BQ622957

Overview
NameBQ622957
Unique NameBQ622957
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length641
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00048 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00048 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ622957 ID=BQ622957|Name=BQ622957|organism=Citrus sinensis|type=EST|length=641bp
TCTAAAACTTTACTCAGATTTTGTTATCAAGATTCCTCCCTCTGGATTAT
GTTTTCGAAGTTTGAAGGTTCTTACTGTTGTACTAGAATATCCTGATAAC
AACCTGACTGAGAGACTCTTTTCTATTTGTCCTGCTCTTGAGGATTTGTC
AATAGGACATCTGGATGATAAATCTTTGATTAACTTCAACATTTCATCCA
CTACTTTGAAGAGGTTATGCTTATCGTTTACAAACGGAGTAGCTTATAGT
AACAATTGGCACAAAGTTATGATTGCAACTCCAAATCTTGAGCTGCTCAA
TATTCATGATTTTTGCATGGTTTCCTATATGTTTCATGAACTACCTCCCT
TTACTAAAGTGTTTATTGATATTTTCTATGACGATGGATGGTCATGGGTT
CAGTCTGGCCGTGCTCAACGGCTACTTAATAGTCTCACTAAAGCCAAGTT
TCTTGCTTTATCTGCTGACACTGTATATGTAAGTCCACTCCATCATGTTC
TAAGACCCTCATACATATCTTATTCATGTCTCTACCTTTTTTTTTTGGGT
TAATTTATTATTTTGCTGTAAGCCAGCTAACAGCGACGACATTGGTTTAA
AACTGATTGTGGGGACATTTTCTGGTAAGGAAATTAAATTG
back to top