BQ622958

Overview
NameBQ622958
Unique NameBQ622958
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length455
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig386 contig Csv1_Contig386:25..479. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00049 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00049 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ622958 ID=BQ622958|Name=BQ622958|organism=Citrus sinensis|type=EST|length=455bp
GCCAAAACACATATTATTAATCTTCTATTTAATATTTTTTCTATTAGCAA
GGTTAAATTAAATACTTTGTGAGAGCAATGGCATCATTGAAGGCTGAGAA
ACCTGTTGGTACCCAACTCTTTGGGCAGACCAAAAAGGAACCTGCAGCCA
AGGCCAGCGAAGGTGCTTCCAAAGCTCAAGGCTCCAAGTCTGGCGCTAAG
AAATCTGCACAGAAGCCGCAGGAGCCTAAGAAGAAGGGAAAAGGTGGCAA
ATCAGCAGCGAAGCCCTAGTTTGGCGTTACAGAAGCGGCTAAACTGAGGC
AATGAAGTACTACTAATCACCTCATAGTATTTAATTTCCTAAATGTTTTT
CTTTAGTTGACCCCCTCATAGCTGGGCATCTATGTAAGGCCCGCTTGCTA
CGCTTGCACTGAAATAAAATTGCTATTTACAAACACTCTTTTTCCTAGCA
AAAAA
back to top